|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939932 |
1105939945 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138828-25138850
|
13:25138879-25138901
|
| Sequence |
CCTCCCGGGCAGCTGGGATTACA |
CTGTGTTTTTAGTAGAGATGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 1993, 2: 56816, 3: 227259, 4: 281254} |
{0: 48, 1: 4986, 2: 93310, 3: 182047, 4: 180271} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|