|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939934 |
1105939944 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138831-25138853
|
13:25138878-25138900
|
| Sequence |
CCCGGGCAGCTGGGATTACAGGC |
TCTGTGTTTTTAGTAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 32, 1: 3376, 2: 85653, 3: 222098, 4: 251147} |
{0: 44, 1: 5266, 2: 101853, 3: 249405, 4: 160689} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|