ID: 1105943455_1105943463

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1105943455 1105943463
Species Human (GRCh38) Human (GRCh38)
Location 13:25170826-25170848 13:25170856-25170878
Sequence CCTGCGGGCTCACCTGCTGGGTC GCGTCCTGGCTGGGCTCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 174} {0: 1, 1: 0, 2: 1, 3: 32, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!