ID: 1105981960_1105981965

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1105981960 1105981965
Species Human (GRCh38) Human (GRCh38)
Location 13:25526661-25526683 13:25526704-25526726
Sequence CCTGTGGGATGAACCTCCTACAG ACTGCAATTTGGTATCTCTTTGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 18, 3: 33, 4: 197} {0: 1, 1: 0, 2: 2, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!