ID: 1106871713_1106871715

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1106871713 1106871715
Species Human (GRCh38) Human (GRCh38)
Location 13:34029071-34029093 13:34029087-34029109
Sequence CCTGAGAAGTGAAAGACTGAATA CTGAATATACAGATGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 243} {0: 3, 1: 21, 2: 46, 3: 82, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!