|
Left Crispr |
Right Crispr |
| Crispr ID |
1107034199 |
1107034203 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:35883455-35883477
|
13:35883481-35883503
|
| Sequence |
CCACCATGAGTGGAAGTAGCTTG |
CCCTCAGCAGATGCAAATGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 137, 3: 270, 4: 806} |
{0: 1, 1: 3, 2: 76, 3: 458, 4: 966} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|