ID: 1107642101_1107642106

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1107642101 1107642106
Species Human (GRCh38) Human (GRCh38)
Location 13:42454006-42454028 13:42454034-42454056
Sequence CCACCTCCTGGATTCAAGGGATT GCCTCGGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary No data {0: 1367, 1: 88932, 2: 195375, 3: 232005, 4: 164282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!