|
Left Crispr |
Right Crispr |
| Crispr ID |
1107914285 |
1107914288 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:45133463-45133485
|
13:45133494-45133516
|
| Sequence |
CCAGCACTCCCTCAACATAGGGA |
ACAAATTTTCATTTGTTTTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 19, 1: 37, 2: 31, 3: 22, 4: 129} |
{0: 1, 1: 28, 2: 24, 3: 139, 4: 1428} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|