ID: 1107942947_1107942951

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1107942947 1107942951
Species Human (GRCh38) Human (GRCh38)
Location 13:45391065-45391087 13:45391099-45391121
Sequence CCATCATTGTCGATTCGATCAAC GCCTCTCCTTGCTCTCGTCCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 1, 4: 31} {0: 2, 1: 1, 2: 1, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!