|
Left Crispr |
Right Crispr |
| Crispr ID |
1107963355 |
1107963359 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:45578044-45578066
|
13:45578083-45578105
|
| Sequence |
CCTAGGTCCATCTGTGCACTTCC |
TAGCAAGAACCCTGCTAAGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 26, 2: 63, 3: 90, 4: 233} |
{0: 2, 1: 7, 2: 18, 3: 53, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|