ID: 1108065955_1108065956

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1108065955 1108065956
Species Human (GRCh38) Human (GRCh38)
Location 13:46577855-46577877 13:46577874-46577896
Sequence CCAGACTGCTGTCATTTACAATT AATTGCTAGAGAACAAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 203} {0: 1, 1: 0, 2: 0, 3: 25, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!