ID: 1108086924_1108086937

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1108086924 1108086937
Species Human (GRCh38) Human (GRCh38)
Location 13:46803506-46803528 13:46803559-46803581
Sequence CCTCCAGAACTTTTGACCTACCT TTTGGGTTCAATTAATTTGCTGG
Strand - +
Off-target summary No data {0: 21, 1: 76, 2: 121, 3: 117, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!