ID: 1108272055_1108272073

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1108272055 1108272073
Species Human (GRCh38) Human (GRCh38)
Location 13:48771285-48771307 13:48771337-48771359
Sequence CCCTCCGGGCCCCACTGGACATC TGAGATGGAAACAGATAAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 34, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!