ID: 1108272065_1108272073

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1108272065 1108272073
Species Human (GRCh38) Human (GRCh38)
Location 13:48771313-48771335 13:48771337-48771359
Sequence CCCAGACCCTCCACCCAAGGATG TGAGATGGAAACAGATAAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 34, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!