|
Left Crispr |
Right Crispr |
| Crispr ID |
1108302431 |
1108302439 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:49091967-49091989
|
13:49092012-49092034
|
| Sequence |
CCAAAGCCCAGTAACGGGCCAAG |
TGTTATCTGCGGAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 178, 2: 171, 3: 102, 4: 130} |
{0: 1, 1: 5, 2: 204, 3: 200, 4: 188} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|