|
Left Crispr |
Right Crispr |
| Crispr ID |
1108302433 |
1108302440 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:49091974-49091996
|
13:49092013-49092035
|
| Sequence |
CCAGTAACGGGCCAAGAGCTGTC |
GTTATCTGCGGAAGATGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 170, 2: 191, 3: 131, 4: 143} |
{0: 4, 1: 184, 2: 175, 3: 137, 4: 198} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|