ID: 1108521606_1108521617

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1108521606 1108521617
Species Human (GRCh38) Human (GRCh38)
Location 13:51251592-51251614 13:51251618-51251640
Sequence CCTCCCGCTGTTCCGGGTGTCCG GGCGGGCGTCCCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53} {0: 1, 1: 2, 2: 8, 3: 101, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!