|
Left Crispr |
Right Crispr |
| Crispr ID |
1109293221 |
1109293225 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:60500091-60500113
|
13:60500129-60500151
|
| Sequence |
CCTGCCATCTTCTGTGGATAACT |
GACGGCTCTTGGCCTGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 205, 3: 199, 4: 265} |
{0: 4, 1: 163, 2: 192, 3: 136, 4: 163} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|