|
Left Crispr |
Right Crispr |
Crispr ID |
1109293221 |
1109293228 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:60500091-60500113
|
13:60500139-60500161
|
Sequence |
CCTGCCATCTTCTGTGGATAACT |
GGCCTGTTACTGGGTTTTGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 12, 2: 205, 3: 199, 4: 265} |
{0: 9, 1: 153, 2: 156, 3: 86, 4: 215} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|