ID: 1109538084_1109538091

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1109538084 1109538091
Species Human (GRCh38) Human (GRCh38)
Location 13:63741461-63741483 13:63741488-63741510
Sequence CCTCGCGGGGGGTGCCTCCCGCC CGATGGTGGTCCTAAGAGCCAGG
Strand - +
Off-target summary No data {0: 5, 1: 98, 2: 151, 3: 113, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!