ID: 1109547135_1109547152

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1109547135 1109547152
Species Human (GRCh38) Human (GRCh38)
Location 13:63844224-63844246 13:63844272-63844294
Sequence CCCGCGAGGCAGGGAGTAAGAGC AGGACCTCCATCACAGTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 54, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!