ID: 1109766471_1109766477

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1109766471 1109766477
Species Human (GRCh38) Human (GRCh38)
Location 13:66906585-66906607 13:66906619-66906641
Sequence CCAAGCCTCTCCTGTGTTTCATT CCTGTTTTTGGAACAGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 475} {0: 1, 1: 0, 2: 0, 3: 16, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!