ID: 1109766473_1109766477

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1109766473 1109766477
Species Human (GRCh38) Human (GRCh38)
Location 13:66906590-66906612 13:66906619-66906641
Sequence CCTCTCCTGTGTTTCATTCTGGA CCTGTTTTTGGAACAGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 284} {0: 1, 1: 0, 2: 0, 3: 16, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!