ID: 1109961762_1109961767

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1109961762 1109961767
Species Human (GRCh38) Human (GRCh38)
Location 13:69640043-69640065 13:69640070-69640092
Sequence CCCTCCCTCAGATGCACAGATTC TATGCAACATGGCCACTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 78, 4: 377} {0: 1, 1: 0, 2: 6, 3: 27, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!