ID: 1109987156_1109987158

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1109987156 1109987158
Species Human (GRCh38) Human (GRCh38)
Location 13:70002567-70002589 13:70002604-70002626
Sequence CCAAAATTTAACTTATACTTTAA AATCTCAGTGAACCCCAATCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 863} {0: 2, 1: 0, 2: 7, 3: 59, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!