|
Left Crispr |
Right Crispr |
| Crispr ID |
1110212301 |
1110212305 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:72987952-72987974
|
13:72987975-72987997
|
| Sequence |
CCCCGGGTTTATGTGATTCTCCT |
GCCTCAGCCTCCCAAGTAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 22, 2: 395, 3: 2208, 4: 4930} |
{0: 2348, 1: 88449, 2: 198708, 3: 240149, 4: 234925} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|