ID: 1110889814_1110889825

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1110889814 1110889825
Species Human (GRCh38) Human (GRCh38)
Location 13:80684785-80684807 13:80684820-80684842
Sequence CCCTCTACTTTTTGAAATTGTGA GGGTGGGTACAGAAGGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 71, 4: 796}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!