ID: 1111057798_1111057803

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1111057798 1111057803
Species Human (GRCh38) Human (GRCh38)
Location 13:82973016-82973038 13:82973030-82973052
Sequence CCAGTAACAGGCCAAGAGCTGTC AGAGCTGTCTCTCAAACTGGGGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!