ID: 1111795203_1111795206

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1111795203 1111795206
Species Human (GRCh38) Human (GRCh38)
Location 13:92910557-92910579 13:92910574-92910596
Sequence CCAAGGTGGCCAAACGAGTGGCT GTGGCTGAGATGATTCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!