|
Left Crispr |
Right Crispr |
| Crispr ID |
1111844924 |
1111844934 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:93496110-93496132
|
13:93496162-93496184
|
| Sequence |
CCCCTCCCCCAGCCTTGCTGCCT |
TAGCAATCAGCGAGAGTCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 395, 2: 2089, 3: 2275, 4: 2204} |
{0: 2, 1: 1411, 2: 1161, 3: 881, 4: 953} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|