|
Left Crispr |
Right Crispr |
| Crispr ID |
1111858211 |
1111858215 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:93667678-93667700
|
13:93667708-93667730
|
| Sequence |
CCACCTTGGCCTTGTGCTGGGAT |
GTAAACCACCACACCCAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 4, 2: 13, 3: 40, 4: 373} |
{0: 1, 1: 28, 2: 456, 3: 1792, 4: 4897} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|