ID: 1112135972_1112135977

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1112135972 1112135977
Species Human (GRCh38) Human (GRCh38)
Location 13:96578111-96578133 13:96578129-96578151
Sequence CCCGCACATTCCCTTATCCTCCC CTCCCACACAAGTCCAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 287} {0: 2, 1: 0, 2: 1, 3: 18, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!