ID: 1112761725_1112761733

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1112761725 1112761733
Species Human (GRCh38) Human (GRCh38)
Location 13:102699547-102699569 13:102699583-102699605
Sequence CCCACCATGCCTACTTATAAGGG ATTCCCTCCCAGAGAAGTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!