|
Left Crispr |
Right Crispr |
Crispr ID |
1112763196 |
1112763201 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:102713389-102713411
|
13:102713425-102713447
|
Sequence |
CCACGCCCGGCTAATTTTTGTGT |
GGAGTGTCACTATGTTGGCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 416, 1: 14564, 2: 77416, 3: 161439, 4: 156778} |
{0: 3, 1: 473, 2: 13092, 3: 109934, 4: 245243} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|