ID: 1113244431_1113244438

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1113244431 1113244438
Species Human (GRCh38) Human (GRCh38)
Location 13:108378273-108378295 13:108378302-108378324
Sequence CCTTCCCCGACTACATAGATTCT ATGCCACGTGGCTGCTACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 7, 3: 40, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!