ID: 1113549912_1113549924

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113549912 1113549924
Species Human (GRCh38) Human (GRCh38)
Location 13:111184807-111184829 13:111184843-111184865
Sequence CCGGCCCCGTGGGCTTCACTGTG TGGGAGCAGGTGGGGAGAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 205} {0: 1, 1: 0, 2: 10, 3: 68, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!