ID: 1113549914_1113549923

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1113549914 1113549923
Species Human (GRCh38) Human (GRCh38)
Location 13:111184811-111184833 13:111184835-111184857
Sequence CCCCGTGGGCTTCACTGTGCGGG TGTGTGTCTGGGAGCAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88} {0: 1, 1: 1, 2: 11, 3: 95, 4: 886}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!