|
Left Crispr |
Right Crispr |
| Crispr ID |
1113554956 |
1113554961 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:111225710-111225732
|
13:111225763-111225785
|
| Sequence |
CCATGAACCATGCCCATGTAAGA |
ATTCTGACTGCCCTACTGACCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 26, 2: 82, 3: 226, 4: 506} |
{0: 1, 1: 2, 2: 16, 3: 118, 4: 298} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|