|
Left Crispr |
Right Crispr |
| Crispr ID |
1113735905 |
1113735913 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:112678975-112678997
|
13:112679011-112679033
|
| Sequence |
CCGAGATGGCGGCAGTACAGTCC |
CATCAGAGGGAGACTGTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 150, 1: 893, 2: 395, 3: 401, 4: 10880} |
{0: 4, 1: 88, 2: 17, 3: 35, 4: 370} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|