ID: 1113746718_1113746724

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113746718 1113746724
Species Human (GRCh38) Human (GRCh38)
Location 13:112750275-112750297 13:112750312-112750334
Sequence CCTTCAGCCTCTCGTGAATTTCT GAGTCTCCATCCTCCCACGTGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 0, 3: 13, 4: 164} {0: 9, 1: 2, 2: 2, 3: 14, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!