|
Left Crispr |
Right Crispr |
Crispr ID |
1113775391 |
1113775395 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:112942101-112942123
|
13:112942126-112942148
|
Sequence |
CCTCCACCTCTTGTGGAGGGTCT |
CAGGCCCACCCGCAGTTATCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 182, 2: 135, 3: 47, 4: 173} |
{0: 13, 1: 35, 2: 63, 3: 139, 4: 184} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|