ID: 1113917747_1113917757

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1113917747 1113917757
Species Human (GRCh38) Human (GRCh38)
Location 13:113884331-113884353 13:113884375-113884397
Sequence CCGGCTGAGGGGCACGCGACCCC CTGAGGCGGCCGCAGAGGCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 35, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!