ID: 1113927696_1113927700

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1113927696 1113927700
Species Human (GRCh38) Human (GRCh38)
Location 13:113950703-113950725 13:113950721-113950743
Sequence CCTCTCCTGCAGGGCCCTGGGCA GGGCAGCTTTCTCCCACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 556} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!