ID: 1114092050_1114092061

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1114092050 1114092061
Species Human (GRCh38) Human (GRCh38)
Location 14:19300505-19300527 14:19300543-19300565
Sequence CCAGCCTCCGAGGCCCCGCTCCC GCTCCAGGCTGCGCTCCCCCAGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 4, 3: 50, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!