ID: 1114187426_1114187439

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1114187426 1114187439
Species Human (GRCh38) Human (GRCh38)
Location 14:20413414-20413436 14:20413459-20413481
Sequence CCGATTCCCGCAGCAGGAAGCAG GGTGGGAAGGGTGGCAGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191} {0: 1, 1: 0, 2: 2, 3: 68, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!