ID: 1114187427_1114187437

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1114187427 1114187437
Species Human (GRCh38) Human (GRCh38)
Location 14:20413420-20413442 14:20413457-20413479
Sequence CCCGCAGCAGGAAGCAGAAACTT CCGGTGGGAAGGGTGGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 247} {0: 1, 1: 0, 2: 4, 3: 37, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!