ID: 1114205867_1114205871

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1114205867 1114205871
Species Human (GRCh38) Human (GRCh38)
Location 14:20570741-20570763 14:20570780-20570802
Sequence CCCTGCCATCTTCTGCAGATAAC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 180, 1: 172, 2: 120, 3: 86, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!