ID: 1114344486_1114344497

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1114344486 1114344497
Species Human (GRCh38) Human (GRCh38)
Location 14:21780953-21780975 14:21780989-21781011
Sequence CCCTCTGGACTTTGGGTACTGTT AGGCTTGGAGTAGGGGCCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!