ID: 1114511289_1114511294

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1114511289 1114511294
Species Human (GRCh38) Human (GRCh38)
Location 14:23263609-23263631 14:23263632-23263654
Sequence CCAAGGTGGCCATGTGTGTCAAA GTCAGGGAATCCCTCCTCTTGGG
Strand - +
Off-target summary {0: 20, 1: 14, 2: 7, 3: 12, 4: 160} {0: 1, 1: 19, 2: 19, 3: 15, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!