|
Left Crispr |
Right Crispr |
| Crispr ID |
1114511289 |
1114511296 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:23263609-23263631
|
14:23263642-23263664
|
| Sequence |
CCAAGGTGGCCATGTGTGTCAAA |
CCCTCCTCTTGGGAGCCAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 14, 2: 7, 3: 12, 4: 160} |
{0: 2, 1: 25, 2: 10, 3: 22, 4: 199} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|